Dubious ARS at XII-607

No systematic name assigned

Status: Dubious ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr12:606423-607627
Probably within tandem intergenic space between YLR231C and YLR233C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -165.9 ΔG° (kcal/mol) at location 607253.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 20.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-607 has unique ID: 725

Loading - Please wait...

ARS at XII-607 has unique ID: 725

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr12:606425-607625


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:606519 (Trep: 20.0 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:604000 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-607 has unique ID: 725

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATTTCATATTATGATTTTTTCCCTCACCATTACT  
ACS LOGO:   ACS_logo  

ARS at XII-607 has unique ID: 725

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-607 has unique ID: 725

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-607 has unique ID: 725

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XII-607 has unique ID: 725