Dubious ARS at XII-199

No systematic name assigned

Status: Dubious ARS: Identified by 4 genome-wide studies.

Genomic Location: Chr12:197913-199417
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -165.7 ΔG° (kcal/mol) at location 198183.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-199 has unique ID: 722

Loading - Please wait...

ARS at XII-199 has unique ID: 722

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr12:197915-199415

Shor et al. (2009): Chr12:199000-200200

Shor et al. (2009): Chr12:197000-198100 (orc2-1/wt peak ratio: 0.17)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr12:198361-198861 (Activity detected in: wild-type, rev3 rad30, eco1, ctf4, ddc1, rad24, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-199 has unique ID: 722

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AATATTAATGTTTTCTTACTGTTTAATGCGATGT  
ACS LOGO:   ACS_logo  

ARS at XII-199 has unique ID: 722

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-199 has unique ID: 722

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-199 has unique ID: 722

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XII-199 has unique ID: 722