Confirmed ARS at IV-1

ARS400

Status: Confirmed ARS: Confirmed by ARS assay and identified by 3 genome-wide studies.

Genomic Location: Chr4:137-1392
Within intergenic space between chromosome start and YDL248W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -160.4 ΔG° (kcal/mol) at location 221.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity not detected in HU.

ARS at IV-1 has unique ID: 666

Loading - Please wait...

ARS at IV-1 has unique ID: 666

Studies that cloned this origin

Xu et al. (2006): Chr4:137-1392


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr4:25-2123

Shor et al. (2009): Chr4:200-2000 (orc2-1/wt peak ratio: 0.80)

Müller et al. (2010): Chr4:200-1925 (orc1-bah-delta/wt peak ratio: 0.72)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-1 has unique ID: 666

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATTT  
ACS LOGO:   ACS_logo  

ARS at IV-1 has unique ID: 666

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-1 has unique ID: 666

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-1 has unique ID: 666

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IV-1 has unique ID: 666