Confirmed ARS at II-612

ARS219.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 3 genome-wide studies.

Genomic Location: Chr2:611269-613200
Within tandem intergenic space between YBR195C and YBR196C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.7 ΔG° (kcal/mol) at location 612849.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-612 has unique ID: 661

Loading - Please wait...

ARS at II-612 has unique ID: 661

Studies that cloned this origin

Xu et al. (2006): Chr2:611269-613200

Müller & Nieduszynski (2012): Chr2:611820-612299


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr2:611255-613645

Shor et al. (2009): Chr2:612300-613200 (orc2-1/wt peak ratio: 1.27)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr2:611875-612375 (Activity detected in: ctf4, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-612 has unique ID: 661

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTCTTCCAGTGCGAGTATCTTTCTTGCAAATCGA  
ACS LOGO:   ACS_logo  

ARS at II-612 has unique ID: 661

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-612 has unique ID: 661

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-612 has unique ID: 661

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-612 has unique ID: 661