Confirmed ARS at II-29

ARS201.5

Other names: ARS230

Status: Confirmed ARS: Confirmed by ARS assay and identified by 4 genome-wide studies.

Genomic Location: Chr2:28933-29152
Within tandem intergenic space between YBL101W-C and TF(GAA)B.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -162.7 ΔG° (kcal/mol) at location 29133.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at II-29 has unique ID: 20

Loading - Please wait...

ARS at II-29 has unique ID: 20

Studies that cloned this origin

Nieduszynski et al. (2006): Chr2:28933-29152


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr2:27403-29465

Shor et al. (2009): Chr2:28900-29500 (orc2-1/wt peak ratio: 0.52)

Szilard et al. (2010): Chr2:29045-29055


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr2:35000 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-29 has unique ID: 20

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       CTTTTTTATAATTTGG                   
ACS LOGO:   ACS_logo  

ARS at II-29 has unique ID: 20

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAAAAGTTACGGTCACTCTATCTTTTTTATAATTTGGTCTAACAAACTTGATATCAG
S. kudriavzeviiTAGAACA-CGCTCTTTTT-----TTTTATCATTTGGTCTCAC-AA-----------
S. mikataeGAAAACT----TTCCTCTGTA--TTTTATGATTTGGTCTGAC-ATCGTGGTATTGT
S. paradoxusAAAGATA-CGCTCTCTTGATTTTTTTTATAATTTGGTCTGAC-AACCTGATATCTA
*::::*::*::******************:::::::

ARS at II-29 has unique ID: 20

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-29 has unique ID: 20

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at II-29 has unique ID: 20