Confirmed ARS at VIII-556

ARS824

Other names: X-ARS, proARS824

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr8:555996-556327
Within tandem intergenic space between YHR216W and YHR218W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.5 ΔG° (kcal/mol) at location 556326.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity not detected in HU.

ARS at VIII-556 has unique ID: ARS824

Loading - Please wait...

ARS at VIII-556 has unique ID: ARS824

Studies that cloned this origin

Breier et al. (2004): Chr8:555996-556327


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr8:556619-557030

Xu et al. (2006): Chr8:552265-557845

Shor et al. (2009): Chr8:554400-557000 (orc2-1/wt peak ratio: 0.87)

Szilard et al. (2010): Chr8:556135-556145

Müller et al. (2010): Chr8:554900-557075 (orc1-bah-delta/wt peak ratio: 0.67)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VIII-556 has unique ID: ARS824

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTTTTACGTTTAGGT                   
  Xu et al. (2006):      TTTTACGTTTAGGTGATTTTGGTGGTGATTTTTC  
  Eaton et al. (2010):      AATTTTTACGTTTAGGTGATTTTGGTGGTGATT   
ACS LOGO:   ACS_logo  

ARS at VIII-556 has unique ID: ARS824

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTCTCATTAATGAATAGTTAATTTTTACGTTTAGGTGATTTTGGTGGTGATTTTTC
S. kudriavzeviiTTCTTATTGATAATTAGTATATTTTTATGTTTGGGTAATTTTAGTGGTGATTATTT
S. mikatae---------ATCAACAATTA-TTTCTGTGTT-AGGTTATTTTGGTGGTGATTTTTC
S. paradoxus--------------------ATTTTTATGTTTAGGTGATTTTAGTGGTGATTATTT
::::::***:*:***::*******************

ARS at VIII-556 has unique ID: ARS824

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VIII-556 has unique ID: ARS824

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Breier et al. (2004): PubMed | PubMed Central | Genome Biol.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VIII-556 has unique ID: ARS824