Confirmed ARS at VI-199

ARS607

Other names: proARS607

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:199382-199493
Within tandem intergenic space between YFR022W and YFR023W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -140.2 ΔG° (kcal/mol) at location 199442.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.8 min.
Yabuki et al. (2002) — Trep: 20.4 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-199 has unique ID: ARS607

Loading - Please wait...

ARS at VI-199 has unique ID: ARS607

Studies that cloned this origin

Shirahige et al. (1993): Chr6:199382-199493


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:195811-202876

Szyjka et al. (2005): Chr6:196969-202450


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:199021-199861

Xu et al. (2006): Chr6:197805-200275

Shor et al. (2009): Chr6:198200-200300 (orc2-1/wt peak ratio: 0.63)

Szilard et al. (2010): Chr6:199535-199545

Müller et al. (2010): Chr6:198350-201350 (orc1-bah-delta/wt peak ratio: 0.66)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:196033 (Trep: 12.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:198613 (Trep: 20.4 min.)

Alvino et al. (2007): Chr6:199330 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:200000 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr6:199382-199493 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-199 has unique ID: ARS607

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         GTTTATATTTAG                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      CTTGTTTATATTTAGTTACGTTGGGATCAAGTTT  
  Eaton et al. (2010):      CTTGTTTATATTTAGTTACGTTGGGATCAAGTT   
ACS LOGO:   ACS_logo  

ARS at VI-199 has unique ID: ARS607

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-199 has unique ID: ARS607

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-199 has unique ID: ARS607

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed

Szyjka et al. (2005): PubMed | Mol. Cell


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-199 has unique ID: ARS607