Confirmed ARS at VI-168

ARS606

Other names: proARS606

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr6:167606-168041
Within tandem intergenic space between TY(GUA)F1 and YFR012W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -148.4 ΔG° (kcal/mol) at location 167966.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 18.6 min.
Yabuki et al. (2002) — Trep: 20.7 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-168 has unique ID: ARS606

Loading - Please wait...

ARS at VI-168 has unique ID: ARS606

Studies that cloned this origin

Shirahige et al. (1993): Chr6:167606-168041


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:164714-170944


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:167517-167880

Xu et al. (2006): Chr6:167145-168735

Shor et al. (2009): Chr6:167500-168200 (orc2-1/wt peak ratio: 0.66)

Szilard et al. (2010): Chr6:168115-168125


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:168994 (Trep: 18.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:168363 (Trep: 20.7 min.)

Alvino et al. (2007): Chr6:167560 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:167500 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr6:167606-168041 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-168 has unique ID: ARS606

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TATTTATATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TATATTTATATTTTCGTTTGCAATTTCGCAATTT  
ACS LOGO:   ACS_logo  

ARS at VI-168 has unique ID: ARS606

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-168 has unique ID: ARS606

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-168 has unique ID: ARS606

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VI-168 has unique ID: ARS606