Confirmed ARS at VI-128

ARS604

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 7 genome-wide studies.

Genomic Location: Chr6:127745-128066
Within gene: YFL007W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.8 ΔG° (kcal/mol) at location 127865.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 21.5 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-128 has unique ID: ARS604

Loading - Please wait...

ARS at VI-128 has unique ID: ARS604

Studies that cloned this origin

Shirahige et al. (1993): Chr6:127745-128066


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:125914-132085


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr6:127725-129315

Shor et al. (2009): Chr6:127400-128600 (orc2-1/wt peak ratio: 0.07)

Szilard et al. (2010): Chr6:128235-128245

Müller et al. (2010): Chr6:127475-128375 (orc1-bah-delta/wt peak ratio: 1.34)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:122427 (Trep: 21.5 min.) (Confidence: 9)

Alvino et al. (2007): Chr6:122670 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr6:127745-128066 (Activity detected in: rev3 rad30, eco1, ctf4, ddc1, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-128 has unique ID: ARS604

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTTACGTTTTG                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TCATTTTACGTTTTGTTACACAAATCCAATCGAA  
  Eaton et al. (2010):      TCATTTTACGTTTTGTTACACAAATCCAATCGA   
ACS LOGO:   ACS_logo  

ARS at VI-128 has unique ID: ARS604

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-128 has unique ID: ARS604

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-128 has unique ID: ARS604

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-128 has unique ID: ARS604