Confirmed ARS at VI-69

ARS603

Other names: proARS603

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:68690-68869
Within convergent intergenic space between YFL034W and YFL033C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -130.2 ΔG° (kcal/mol) at location 68830.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 36.2 min.
Yabuki et al. (2002) — Trep: 30.0 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-69 has unique ID: ARS603

Loading - Please wait...

ARS at VI-69 has unique ID: ARS603

Studies that cloned this origin

Shirahige et al. (1993): Chr6:68690-68869


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:65833-70724

Aparicio et al. (2004): Chr6:67119-70719

Gibson et al. (2004): Chr6:67119-70719

Hu & Aparicio (2005): Chr6:67119-70719


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:68697-69114

Xu et al. (2006): Chr6:67443-69621

Shor et al. (2009): Chr6:68400-69100 (orc2-1/wt peak ratio: 0.62)

Szilard et al. (2010): Chr6:68845-68855

Müller et al. (2010): Chr6:68375-69275 (orc1-bah-delta/wt peak ratio: 0.79)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:66346 (Trep: 36.2 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:70363 (Trep: 30.0 min.)

Alvino et al. (2007): Chr6:66875 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:68333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:68690-68869 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-69 has unique ID: ARS603

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTAAAGTTTTG                     
  Shirahige et al. (1993):         ATTTCATATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TAATTTCATATTTTGTATCAAAACTTTAAAATCT  
  Xu et al. (2006):      GATTTTAAAGTTTTGATACAAAATATGAAATTAG  
ACS LOGO:   ACS_logo  

ARS at VI-69 has unique ID: ARS603

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-69 has unique ID: ARS603

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-69 has unique ID: ARS603

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Hu & Aparicio (2005): PubMed | PubMed Central | Proc. Natl. Acad. Sci. U.S.A.


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VI-69 has unique ID: ARS603