Confirmed ARS at VI-69

ARS603

Other names: proARS603

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:68690-68869
Within convergent intergenic space between YFL034W and YFL033C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -130.2 ΔG° (kcal/mol) at location 68830.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 36.2 min.
Yabuki et al. (2002) — Trep: 30.0 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-69 has unique ID: ARS603

Loading - Please wait...

ARS at VI-69 has unique ID: ARS603

Studies that cloned this origin

Shirahige et al. (1993): Chr6:68690-68869


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:65833-70724

Aparicio et al. (2004): Chr6:67119-70719

Gibson et al. (2004): Chr6:67119-70719

Hu & Aparicio (2005): Chr6:67119-70719


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:68697-69114

Xu et al. (2006): Chr6:67443-69621

Shor et al. (2009): Chr6:68400-69100 (orc2-1/wt peak ratio: 0.62)

Szilard et al. (2010): Chr6:68845-68855

Müller et al. (2010): Chr6:68375-69275 (orc1-bah-delta/wt peak ratio: 0.79)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:66346 (Trep: 36.2 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:70363 (Trep: 30.0 min.)

Alvino et al. (2007): Chr6:66875 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:68333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:68690-68869 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-69 has unique ID: ARS603

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTAAAGTTTTG                     
  Shirahige et al. (1993):         ATTTCATATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TAATTTCATATTTTGTATCAAAACTTTAAAATCT  
  Xu et al. (2006):      GATTTTAAAGTTTTGATACAAAATATGAAATTAG  
ACS LOGO:   ACS_logo  

ARS at VI-69 has unique ID: ARS603

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-69 has unique ID: ARS603

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-69 has unique ID: ARS603

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Hu & Aparicio (2005): PubMed | PubMed Central | Proc. Natl. Acad. Sci. U.S.A.


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VI-69 has unique ID: ARS603