Confirmed ARS at V-499

ARS520

Other names: proARS520

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr5:498417-499343
Within tandem intergenic space between TR(ACG)E and YER161C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -153.2 ΔG° (kcal/mol) at location 499337.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.1 min.
Yabuki et al. (2002) — Trep: 24.4 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-499 has unique ID: ARS520

Loading - Please wait...

ARS at V-499 has unique ID: ARS520

Studies that cloned this origin

Study details not curated: Chr5:498417-499343

Müller & Nieduszynski (2012): Chr5:498746-499244


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr5:498417-499343

Xu et al. (2006): Chr5:498585-500265

Shor et al. (2009): Chr5:498400-499700 (orc2-1/wt peak ratio: 0.54)

Szilard et al. (2010): Chr5:499015-499025

Müller et al. (2010): Chr5:498350-500150 (orc1-bah-delta/wt peak ratio: 0.84)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr5:499947 (Trep: 29.1 min.) (Confidence: 9)

Yabuki et al. (2002): Chr5:502386 (Trep: 24.4 min.)

Alvino et al. (2007): Chr5:498250 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr5:500000 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-499 has unique ID: ARS520

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTGATATATGTTTTGATATATGGACGTGAAATGA  
  Xu et al. (2006):      CATATTTATGTTTAGTTTCCGAATGCTTTTGTAA  
  Eaton et al. (2010):      CATATTTATGTTTAGTTTCCGAATGCTTTTGTA   
ACS LOGO:   ACS_logo  

ARS at V-499 has unique ID: ARS520

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at V-499 has unique ID: ARS520

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-499 has unique ID: ARS520

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at V-499 has unique ID: ARS520