Confirmed ARS at IV-463

ARS416

Other names: ARS1, proARS416

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr4:462430-462700
Within tandem intergenic space between YDR007W and YDR009W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -156.9 ΔG° (kcal/mol) at location 462700.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 23.3 min.
Yabuki et al. (2002) — Trep: 21.3 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-463 has unique ID: ARS416

Loading - Please wait...

ARS at IV-463 has unique ID: ARS416

Studies that cloned this origin

Study details not curated: Chr4:462430-462700


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): Chr4:459716-464389

Aparicio et al. (2004): Chr4:459716-464384


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:462643-463475

Xu et al. (2006): Chr4:461475-464265

Shor et al. (2009): Chr4:462000-464700 (orc2-1/wt peak ratio: 0.55)

Szilard et al. (2010): Chr4:462555-462565

Müller et al. (2010): Chr4:461975-463775 (orc1-bah-delta/wt peak ratio: 0.62)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:464369 (Trep: 23.3 min.) (Confidence: 9)

Yabuki et al. (2002): Chr4:461541 (Trep: 21.3 min.)

Alvino et al. (2007): Chr4:460800 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:463666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr4:462430-462700 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-463 has unique ID: ARS416

Studies that confirmed an essential ACS element

  Celniker et al. (1984):         ATTTTATGTTTA                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      CAGATTTTATGTTTAGATCTTTTATGCTTGCTTT  
  Eaton et al. (2010):      AGATTTTATGTTTAGATCTTTTATGCTTGCTTT   
ACS LOGO:   ACS_logo  

ARS at IV-463 has unique ID: ARS416

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-463 has unique ID: ARS416

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-463 has unique ID: ARS416

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Celniker et al. (1984): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-463 has unique ID: ARS416