Confirmed ARS at IV-46

ARS404

Other names: HO, proARS404

Status: Confirmed ARS: Confirmed by ARS assay and identified by 10 genome-wide studies.

Genomic Location: Chr4:46181-46237
Within convergent intergenic space between YDL229W and YDL227C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -149.3 ΔG° (kcal/mol) at location 46231.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 36.5 min.
Yabuki et al. (2002) — Trep: 27.4 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-46 has unique ID: ARS404

Loading - Please wait...

ARS at IV-46 has unique ID: ARS404

Studies that cloned this origin

Xu et al. (2006): Chr4:46181-46237


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:45919-46272

Xu et al. (2006): Chr4:44390-48176

Shor et al. (2009): Chr4:45200-47700 (orc2-1/wt peak ratio: 0.58)

Szilard et al. (2010): Chr4:46285-46295

Müller et al. (2010): Chr4:45800-47300 (orc1-bah-delta/wt peak ratio: 0.63)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:43761 (Trep: 36.5 min.) (Confidence: 9)

Yabuki et al. (2002): Chr4:46791 (Trep: 27.4 min.)

Alvino et al. (2007): Chr4:47429 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:47333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr4:46181-46237 (Activity detected in: ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-46 has unique ID: ARS404

Studies that confirmed an essential ACS element

  Kearsey (1984):         ATTTAATATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      AAATTTAATATTTTGGATGAAAAAAACCATTTTT  
  Eaton et al. (2010):      AAATTTAATATTTTGGATGAAAAAAACCATTTT   
ACS LOGO:   ACS_logo  

ARS at IV-46 has unique ID: ARS404

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-46 has unique ID: ARS404

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-46 has unique ID: ARS404

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Kearsey (1984): PubMed


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-46 has unique ID: ARS404