Confirmed ARS at IV-16

ARS403

Other names: proARS403

Status: Confirmed ARS: Confirmed by ARS assay and identified by 3 genome-wide studies.

Genomic Location: Chr4:15492-15739
Within divergent intergenic space between YDL245C and YDL244W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -148.0 ΔG° (kcal/mol) at location 15732.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-16 has unique ID: ARS403

Loading - Please wait...

ARS at IV-16 has unique ID: ARS403

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:15492-15739


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:14782-16204

Xu et al. (2006): Chr4:13982-16999


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:16000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-16 has unique ID: ARS403

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTACGTTTTCTC                   
  Xu et al. (2006):      ATTTTTTACGTTTTCTCCATATTTCGAATTGTTC  
  Xu et al. (2006):      TTTTTTATTATTTTGATTGAAGAAGGAACAATTC  
ACS LOGO:   ACS_logo  

ARS at IV-16 has unique ID: ARS403

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTTCGATTATAACTCTAACATTTTTTACGTTTTCTCCATATTTCGAATTGTTCCTT
S. paradoxusTTTTGATCCTAAATATAACATTTTTTAATTTTTGTACATAGTTGTATATGTTCTTT
***:***::***:*:************::****:*:****:**::*::*****:**

ARS at IV-16 has unique ID: ARS403

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-16 has unique ID: ARS403

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IV-16 has unique ID: ARS403