Confirmed ARS at III-197

ARS314

Other names: proARS314

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr3:197369-197601
Within tandem intergenic space between YCR037C and YCR038C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -147.3 ΔG° (kcal/mol) at location 197559.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 16.9 min.
Yabuki et al. (2002) — Trep: 28.8 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-197 has unique ID: ARS314

Loading - Please wait...

ARS at III-197 has unique ID: ARS314

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:195902-197712

Nieduszynski et al. (2006): Chr3:197369-197601


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): Chr3:195138-198617


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:197613-199229

Xu et al. (2006): Chr3:193670-201315

Shor et al. (2009): Chr3:197300-198400 (orc2-1/wt peak ratio: 0.33)

Szilard et al. (2010): Chr3:197425-197435

Müller et al. (2010): Chr3:197150-201200 (orc1-bah-delta/wt peak ratio: 0.51)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:200020 (Trep: 16.9 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:200363 (Trep: 28.8 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:195000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:197369-197601 (Activity detected in: ctf8, ctf18, mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-197 has unique ID: ARS314

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATATTCATGTTTAGTA                   
  Xu et al. (2006):      ATTAATATTCATGTTTAGTACTGAAAATTAAGAA  
  Eaton et al. (2010):      AATATTCATGTTTAGTACTGAAAATTAAGAATA   
ACS LOGO:   ACS_logo  

ARS at III-197 has unique ID: ARS314

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTGTACGCTCACAAATAATTAATATTCATGTTTAGTACTGAAAATTAAGAATACTTG
S. kudriavzeviiCAGGCCTTCATAAATAATCTATATTCATCCATGGGAC----------GACAGTCTG
S. mikataeTTAACGCTAATGATCAATTAATATTCATGTTTAGTACCCATAATTAAAATTGCTTA
S. paradoxusCCCGCCCTCATAAGTAATTGATATTCACATTTAGTAATAAAAATTAAGAGTACCTG
S. bayanusCATATTTTC----GTAATTAATATTCATGTTTAGTACTAAAAA-------------
::*:::::***:*******:::*:*:*::::::::

ARS at III-197 has unique ID: ARS314

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-197 has unique ID: ARS314

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): PubMed | PubMed Central


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-197 has unique ID: ARS314