Confirmed ARS at III-194

ARS313

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 7 genome-wide studies.

Genomic Location: Chr3:194256-194505
Within convergent intergenic space between YCR036W and YCR037C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -151.4 ΔG° (kcal/mol) at location 194396.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 16.9 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-194 has unique ID: ARS313

Loading - Please wait...

ARS at III-194 has unique ID: ARS313

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:194252-195043

Nieduszynski et al. (2006): Chr3:194256-194505


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): Chr3:192312-195908


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:193670-201315

Shor et al. (2009): Chr3:193800-195900 (orc2-1/wt peak ratio: 0.50)

Szilard et al. (2010): Chr3:194385-194395

Müller et al. (2010): Chr3:193775-195125 (orc1-bah-delta/wt peak ratio: 0.82)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:200020 (Trep: 16.9 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:195000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:194256-194505 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-194 has unique ID: ARS313

Studies that confirmed an essential ACS element

  Chang et al. (2008):         TTTTACTTTTAG                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTACTTTTAGTT                   
  Xu et al. (2006):      TTTTACTTTTAGTTTGTTAAATTTTAGTTTTCGT  
  Eaton et al. (2010):      ATTTTTTACTTTTAGTTTGTTAAATTTTAGTTT   
ACS LOGO:   ACS_logo  

ARS at III-194 has unique ID: ARS313

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATGCATAAAATCTACTGCAATTTTTTACTTTTAGTTTGTTAAATTTTAGTTTTCGT
S. kudriavzeviiTTGTATGAAGTATGTGTTAACTTTTTATTTTTAGTTTATAAAATGTCATTTTTCGT
S. mikataeTTTAATGAAATAGGTGACAA-CTTTTATTACTGATTT-TTATATGTTATGTTTCGT
S. paradoxusGTGTGT-AAATCTGTGATAATTTTTTATTTTTAGTTTATAAAATGTTGATTTTTGT
S. bayanusTGTTATGTAATTTGTTTTATTTTTTTATTTTCAGTTT------TTTTATTTTTTCT
::::*::*:*::::*::*****:*:::::***::::**::::***:*

ARS at III-194 has unique ID: ARS313

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-194 has unique ID: ARS313

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): PubMed | PubMed Central


Studies that confirmed an essential ACS element

Chang et al. (2008): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-194 has unique ID: ARS313