Confirmed ARS at III-109

ARS307

Other names: ARS C2G1, proARS307

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr3:108775-109291
Within tandem intergenic space between YCL005W and YCL004W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -151.6 ΔG° (kcal/mol) at location 109105.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 19.8 min.
Yabuki et al. (2002) — Trep: 19.3 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-109 has unique ID: ARS307

Loading - Please wait...

ARS at III-109 has unique ID: ARS307

Studies that cloned this origin

Palzkill et al. (1986): Chr3:108775-109291


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:109150-110226

Xu et al. (2006): Chr3:108100-111025

Szilard et al. (2010): Chr3:109025-109035

Müller et al. (2010): Chr3:108725-109400 (orc1-bah-delta/wt peak ratio: 0.43)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:115906 (Trep: 19.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:109863 (Trep: 19.3 min.)

Alvino et al. (2007): Chr3:113440 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:108250 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:108775-109291 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-109 has unique ID: ARS307

Studies that confirmed an essential ACS element

  Palzkill & Newlon (1988):         TATTTATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTATTTATGTTTTCTTCTTCACACATGGGT  
ACS LOGO:   ACS_logo  

ARS at III-109 has unique ID: ARS307

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-109 has unique ID: ARS307

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-109 has unique ID: ARS307

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Palzkill et al. (1986): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Palzkill & Newlon (1988): PubMed


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-109 has unique ID: ARS307