Confirmed ARS at III-109

ARS307

Other names: ARS C2G1, proARS307

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr3:108775-109291
Within tandem intergenic space between YCL005W and YCL004W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -151.6 ΔG° (kcal/mol) at location 109105.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 19.8 min.
Yabuki et al. (2002) — Trep: 19.3 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-109 has unique ID: ARS307

Loading - Please wait...

ARS at III-109 has unique ID: ARS307

Studies that cloned this origin

Palzkill et al. (1986): Chr3:108775-109291


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:109150-110226

Xu et al. (2006): Chr3:108100-111025

Szilard et al. (2010): Chr3:109025-109035

Müller et al. (2010): Chr3:108725-109400 (orc1-bah-delta/wt peak ratio: 0.43)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:115906 (Trep: 19.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:109863 (Trep: 19.3 min.)

Alvino et al. (2007): Chr3:113440 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:108250 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:108775-109291 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-109 has unique ID: ARS307

Studies that confirmed an essential ACS element

  Palzkill & Newlon (1988):         TATTTATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTATTTATGTTTTCTTCTTCACACATGGGT  
ACS LOGO:   ACS_logo  

ARS at III-109 has unique ID: ARS307

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-109 has unique ID: ARS307

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-109 has unique ID: ARS307

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Palzkill et al. (1986): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Palzkill & Newlon (1988): PubMed


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-109 has unique ID: ARS307