Confirmed ARS at III-75

ARS306

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr3:74457-74677
Within tandem intergenic space between YCL026C-B and YCL026C-A.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.0 ΔG° (kcal/mol) at location 74617.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 10.8 min.
Yabuki et al. (2002) — Trep: 17.9 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-75 has unique ID: ARS306

Loading - Please wait...

ARS at III-75 has unique ID: ARS306

Studies that cloned this origin

Newlon et al. (1991): Chr3:74457-74677


Studies that analyzed this origin by 2D gel

Szyjka et al. (2005): Chr3:72852-77073


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:71881-75850

Shor et al. (2009): Chr3:74200-75100 (orc2-1/wt peak ratio: 0.54)

Szilard et al. (2010): Chr3:74555-74565

Müller et al. (2010): Chr3:74150-74750 (orc1-bah-delta/wt peak ratio: 0.29)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:77855 (Trep: 10.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:74863 (Trep: 17.9 min.)

Alvino et al. (2007): Chr3:72000 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:73500 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:74457-74677 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-75 has unique ID: ARS306

Studies that confirmed an essential ACS element

  Theis et al. (1999):         ATTTATATTTAT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TGTATTTATATTTATTTAGTACTTCTTGAGTTTA  
ACS LOGO:   ACS_logo  

ARS at III-75 has unique ID: ARS306

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-75 has unique ID: ARS306

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-75 has unique ID: ARS306

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Szyjka et al. (2005): PubMed | Mol. Cell


Studies that confirmed an essential ACS element

Theis et al. (1999): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-75 has unique ID: ARS306