Confirmed ARS at III-39

ARS305

Other names: ARS A6C, proARS305

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr3:39158-39706
Within tandem intergenic space between YCL050C and YCL049C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -152.9 ΔG° (kcal/mol) at location 39328.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.6 min.
Yabuki et al. (2002) — Trep: 19.7 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-39 has unique ID: ARS305

Loading - Please wait...

ARS at III-39 has unique ID: ARS305

Studies that cloned this origin

Palzkill et al. (1986): Chr3:39158-39706


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): Chr3:36595-42444

Gibson et al. (2004): Chr3:36595-42444

Hu & Aparicio (2005): Chr3:36595-42444

Tourrière et al. (2005): Chr3:36595-42444

Crabbé et al. (2010): Chr3:36595-42444


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:38777-39763

Xu et al. (2006): Chr3:38356-41659

Shor et al. (2009): Chr3:38900-40900 (orc2-1/wt peak ratio: 0.83)

Szilard et al. (2010): Chr3:39555-39565

Müller et al. (2010): Chr3:38750-41900 (orc1-bah-delta/wt peak ratio: 0.65)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:38301 (Trep: 12.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:37863 (Trep: 19.7 min.)

Alvino et al. (2007): Chr3:38333 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:39750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:39158-39706 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-39 has unique ID: ARS305

Studies that confirmed an essential ACS element

  Huang & Kowalski (1996):         TTTATATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTATATGTTTTGTTATGTATTGTTTATTTTC  
  Eaton et al. (2010):      TTTTTATATGTTTTGTTATGTATTGTTTATTTT   
ACS LOGO:   ACS_logo  

ARS at III-39 has unique ID: ARS305

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-39 has unique ID: ARS305

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-39 has unique ID: ARS305

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Palzkill et al. (1986): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Hu & Aparicio (2005): PubMed | PubMed Central | Proc. Natl. Acad. Sci. U.S.A.

Tourrière et al. (2005): PubMed | Mol. Cell

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that confirmed an essential ACS element

Huang & Kowalski (1996): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-39 has unique ID: ARS305