Confirmed ARS at III-39

ARS305

Other names: ARS A6C, proARS305

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr3:39158-39706
Within tandem intergenic space between YCL050C and YCL049C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -152.9 ΔG° (kcal/mol) at location 39328.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.6 min.
Yabuki et al. (2002) — Trep: 19.7 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-39 has unique ID: ARS305

Loading - Please wait...

ARS at III-39 has unique ID: ARS305

Studies that cloned this origin

Palzkill et al. (1986): Chr3:39158-39706


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): Chr3:36595-42444

Gibson et al. (2004): Chr3:36595-42444

Hu & Aparicio (2005): Chr3:36595-42444

Tourrière et al. (2005): Chr3:36595-42444

Crabbé et al. (2010): Chr3:36595-42444


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:38777-39763

Xu et al. (2006): Chr3:38356-41659

Shor et al. (2009): Chr3:38900-40900 (orc2-1/wt peak ratio: 0.83)

Szilard et al. (2010): Chr3:39555-39565

Müller et al. (2010): Chr3:38750-41900 (orc1-bah-delta/wt peak ratio: 0.65)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:38301 (Trep: 12.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:37863 (Trep: 19.7 min.)

Alvino et al. (2007): Chr3:38333 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:39750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:39158-39706 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-39 has unique ID: ARS305

Studies that confirmed an essential ACS element

  Huang & Kowalski (1996):         TTTATATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTATATGTTTTGTTATGTATTGTTTATTTTC  
  Eaton et al. (2010):      TTTTTATATGTTTTGTTATGTATTGTTTATTTT   
ACS LOGO:   ACS_logo  

ARS at III-39 has unique ID: ARS305

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-39 has unique ID: ARS305

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-39 has unique ID: ARS305

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Palzkill et al. (1986): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Hu & Aparicio (2005): PubMed | PubMed Central | Proc. Natl. Acad. Sci. U.S.A.

Tourrière et al. (2005): PubMed | Mol. Cell

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that confirmed an essential ACS element

Huang & Kowalski (1996): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-39 has unique ID: ARS305