Confirmed ARS at II-418

ARS215

Other names: proARS215

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr2:417739-418035
Within convergent intergenic space between YBR085W and YBR085C-A.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -140.3 ΔG° (kcal/mol) at location 417819.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 25.7 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-418 has unique ID: ARS215

Loading - Please wait...

ARS at II-418 has unique ID: ARS215

Studies that cloned this origin

Nieduszynski et al. (2006): Chr2:417739-418035


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr2:416860-417958

Xu et al. (2006): Chr2:416515-418465

Shor et al. (2009): Chr2:417400-418400 (orc2-1/wt peak ratio: 0.34)

Szilard et al. (2010): Chr2:417805-417815

Müller et al. (2010): Chr2:417425-418400 (orc1-bah-delta/wt peak ratio: 0.30)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr2:417419 (Trep: 25.7 min.) (Confidence: 3)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr2:417739-418035 (Activity detected in: ctf4, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-418 has unique ID: ARS215

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTCATACTATGTC                   
ACS LOGO:   ACS_logo  

ARS at II-418 has unique ID: ARS215

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTGCGAAAAATTGATCATCTTTTTCATACTATGTCTTTCATTTCCAACGTCCACA
S. kudriavzeviiATTGCATAGG---------------TACATAATGTCTTTCATCTCTAAAAACCAGA
S. mikataeGCTGCGTAAAATTGAGCATCTTTGTTATATTATGCTTTTCATCTTCAGAATATATA
S. paradoxusATTTCGAAAAACTGATCAACTTTTTCATATTATGACTTTTATCTCCAGTGTCCACA
S. bayanusAAAGCGTGAAATTGAACACCGTTG-TATATCATGTCTTTCACCTCCAAAATTTATA
:::*:::::::::::::*:*:***:***:*::*::*::**

ARS at II-418 has unique ID: ARS215

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-418 has unique ID: ARS215

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at II-418 has unique ID: ARS215