Confirmed ARS at II-379

ARS212

Other names: proARS212

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr2:378434-379194
Within tandem intergenic space between YBR069C and YBR070C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -170.1 ΔG° (kcal/mol) at location 378754.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-379 has unique ID: ARS212

Loading - Please wait...

ARS at II-379 has unique ID: ARS212

Studies that cloned this origin

Xu et al. (2006): Chr2:378434-379194


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr2:379180-379871

Xu et al. (2006): Chr2:378175-379925

Szilard et al. (2010): Chr2:379045-379055


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr2:382330 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr2:378434-379194 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-379 has unique ID: ARS212

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      GCATCAAAGAAGGTGCGGTGCCACCATAAGACTT  
ACS LOGO:   ACS_logo  

ARS at II-379 has unique ID: ARS212

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-379 has unique ID: ARS212

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-379 has unique ID: ARS212

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-379 has unique ID: ARS212