Confirmed ARS at XIII-635

ARS1324

Other names: proARS1324

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr13:634479-634714
Within convergent intergenic space between YMR186W and YMR187C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -143.4 ΔG° (kcal/mol) at location 634549.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-635 has unique ID: ARS1324

Loading - Please wait...

ARS at XIII-635 has unique ID: ARS1324

Studies that cloned this origin

Nieduszynski et al. (2006): Chr13:634479-634714


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:634471-634688

Xu et al. (2006): Chr13:633545-635175

Shor et al. (2009): Chr13:632500-634900 (orc2-1/wt peak ratio: 0.80)

Szilard et al. (2010): Chr13:634655-634665

Müller et al. (2010): Chr13:634325-634850 (orc1-bah-delta/wt peak ratio: 0.67)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:635333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr13:634479-634714 (Activity detected in: ctf4, ddc1, rad24, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-635 has unique ID: ARS1324

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTACTATTTGTAA                   
  Eaton et al. (2010):      TATTTTTACTATTTGTAATAATGATTCTGCTTT   
ACS LOGO:   ACS_logo  

ARS at XIII-635 has unique ID: ARS1324

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTATATAAATTTGTTTACTTATTTTTACTATTTGTAATAATGATTCTGCTTTACGCG
S. kudriavzeviiTATATAAATTTGTTTACTTATTTTTACTATTTGTAATAATGATACTGCTTTACGCG
S. mikataeTATATAAATTTGTTTACTTATTTTTACTATTTGTAATAATGAACCTGCTTTACGCA
S. paradoxusTATATAAA----TTTACTTATTTTTACTATTTGTAATAATGATTCTGCTTTACGCA
S. bayanusTATATAAATTTGTTTACTTATTTTTACTATTTGTAATAATGATACTGCTTTATGCG
********::::******************************:********:**

ARS at XIII-635 has unique ID: ARS1324

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-635 has unique ID: ARS1324

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIII-635 has unique ID: ARS1324