Confirmed ARS at X-737

ARS1024

Other names: proARS1024

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr10:736728-736970
Within convergent intergenic space between YJR159W and YJR160C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -149.7 ΔG° (kcal/mol) at location 736738.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 35.9 min.
Yabuki et al. (2002) — Trep: 31.7 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at X-737 has unique ID: ARS1024

Loading - Please wait...

ARS at X-737 has unique ID: ARS1024

Studies that cloned this origin

Nieduszynski et al. (2006): Chr10:736728-736970


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:736806-737697

Xu et al. (2006): Chr10:734370-738265

Szilard et al. (2010): Chr10:736735-736745


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:738267 (Trep: 35.9 min.) (Confidence: 4)

Yabuki et al. (2002): Chr10:732933 (Trep: 31.7 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-737 has unique ID: ARS1024

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       AATTTTTATTTTTCGG                   
ACS LOGO:   ACS_logo  

ARS at X-737 has unique ID: ARS1024

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTAAACGTGTCTACTATTTAAATTTTTATTTTTCGGTGTTATTTTCAAGTATTACT
S. kudriavzevii-----------------------------------GTTTTCTTATCACGTATTAT-
S. mikataeTTGAACATGCGTTCTATTTGAACGTTTTTTTCTTAGTATTTTTTTCAATTGTTGCC
S. paradoxusTTAAACATGTTTGCTATTTACATTTCTATTTTTCGGTGGTCTTCTCAAGCGTTAC-
:::::::::::::::::::::**:******:::**::

ARS at X-737 has unique ID: ARS1024

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-737 has unique ID: ARS1024

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at X-737 has unique ID: ARS1024