Likely ARS at XVI-454

No systematic name assigned

Status: Likely ARS: Identified by 7 genome-wide studies.

Genomic Location: Chr16:453658-454627
Probably within tandem intergenic space between YPL056C and YPL055C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -170.2 ΔG° (kcal/mol) at location 454458.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 24.2 min.
Yabuki et al. (2002) — Trep: 27.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XVI-454 has unique ID: 769

Loading - Please wait...

ARS at XVI-454 has unique ID: 769

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr16:453660-454625

Shor et al. (2009): Chr16:453900-454900 (orc2-1/wt peak ratio: 0.31)

Müller et al. (2010): Chr16:453800-454775 (orc1-bah-delta/wt peak ratio: 0.49)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:455478 (Trep: 24.2 min.) (Confidence: 1)

Yabuki et al. (2002): Chr16:455633 (Trep: 27.1 min.)

Alvino et al. (2007): Chr16:457110 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr16:457000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-454 has unique ID: 769

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      GATTTTTAGGTTTAGTTCTTCCAAAGCGGAATC   
ACS LOGO:   ACS_logo  

ARS at XVI-454 has unique ID: 769

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XVI-454 has unique ID: 769

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-454 has unique ID: 769

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XVI-454 has unique ID: 769