Confirmed ARS at IV-351

ARS413.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 1 genome-wide studies.

Genomic Location: Chr4:350835-351804
Within tandem intergenic space between YDL058W and YDL057W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.9 ΔG° (kcal/mol) at location 351705.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity not detected in HU.

ARS at IV-351 has unique ID: 669

Loading - Please wait...

ARS at IV-351 has unique ID: 669

Studies that cloned this origin

Xu et al. (2006): Chr4:350835-351804


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr4:350835-351955


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-351 has unique ID: 669

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AATGTTATATTTTCTATAACATCTAACATTACTT  
ACS LOGO:   ACS_logo  

ARS at IV-351 has unique ID: 669

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-351 has unique ID: 669

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-351 has unique ID: 669

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IV-351 has unique ID: 669