Confirmed ARS at VIII-214

ARS810

Other names: proARS810

Status: Confirmed ARS: Confirmed by ARS assay and identified by 4 genome-wide studies.

Genomic Location: Chr8:213179-213861
Probably within gene: YHR054C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -144.0 ΔG° (kcal/mol) at location 213859.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 44.9 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at VIII-214 has unique ID: ARS810

Loading - Please wait...

ARS at VIII-214 has unique ID: ARS810

Studies that cloned this origin

Liachko et al. (2010): Chr8:213179-213861


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr8:212720-213185

Xu et al. (2006): Chr8:212455-216205

Szilard et al. (2010): Chr8:213235-213245


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr8:214430 (Trep: 44.9 min.) (Confidence: 5)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VIII-214 has unique ID: ARS810

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TAATTTCTATTTTTTTTAAAATTTCCAAAATCTT  
ACS LOGO:   ACS_logo  

ARS at VIII-214 has unique ID: ARS810

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VIII-214 has unique ID: ARS810

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VIII-214 has unique ID: ARS810

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Liachko et al. (2010): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VIII-214 has unique ID: ARS810