Confirmed ARS at VII-241

ARS712

Other names: proARS712

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr7:240972-241441
Within convergent intergenic space between YGL141W and YGL140C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -152.6 ΔG° (kcal/mol) at location 241402.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-241 has unique ID: ARS712

Loading - Please wait...

ARS at VII-241 has unique ID: ARS712

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr7:240972-241441


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:241088-241356

Xu et al. (2006): Chr7:240395-242125

Szilard et al. (2010): Chr7:241145-241155


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:241000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr7:240393-242127 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-241 has unique ID: ARS712

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AATTTAAGTTTTGCTTTGTTCGCCACCATTCTAG  
ACS LOGO:   ACS_logo  

ARS at VII-241 has unique ID: ARS712

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-241 has unique ID: ARS712

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-241 has unique ID: ARS712

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-241 has unique ID: ARS712