Confirmed ARS at VI-256

ARS609

Other names: proARS609

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 8 genome-wide studies.

Genomic Location: Chr6:256263-256418
Within divergent intergenic space between YFR053C and YFR055W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -149.4 ΔG° (kcal/mol) at location 256263.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 31.8 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-256 has unique ID: ARS609

Loading - Please wait...

ARS at VI-256 has unique ID: ARS609

Studies that cloned this origin

Shirahige et al. (1993): Chr6:256263-256418


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:253670-259874


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:256305-257573

Xu et al. (2006): Chr6:255595-258310

Shor et al. (2009): Chr6:255800-258400 (orc2-1/wt peak ratio: 0.86)

Szilard et al. (2010): Chr6:256625-256635

Müller et al. (2010): Chr6:255650-257675 (orc1-bah-delta/wt peak ratio: 0.62)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr6:257363 (Trep: 31.8 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:257000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:256263-256418 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-256 has unique ID: ARS609

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTTTATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTTATGTTTTTTCCGGAATTGGCTAAATTC  
  Eaton et al. (2010):      TTTTTTTATGTTTTTTCCGGAATTGGCTAAATT   
ACS LOGO:   ACS_logo  

ARS at VI-256 has unique ID: ARS609

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-256 has unique ID: ARS609

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-256 has unique ID: ARS609

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-256 has unique ID: ARS609