Confirmed ARS at VI-33

ARS602

Other names: proARS601/proARS602

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:32666-33247
Within tandem intergenic space between YFL051C and YFL050C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -154.0 ΔG° (kcal/mol) at location 33246.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 42.4 min.
Yabuki et al. (2002) — Trep: 32.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-33 has unique ID: ARS602

Loading - Please wait...

ARS at VI-33 has unique ID: ARS602

Studies that cloned this origin

Shirahige et al. (1993): Chr6:32666-33247

Shirahige et al. (1993): Chr6:32472-32995


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:29727-34843


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:31906-33272

Xu et al. (2006): Chr6:31647-34439

Shor et al. (2009): Chr6:31500-33800 (orc2-1/wt peak ratio: 0.58)

Szilard et al. (2010): Chr6:32875-32885

Müller et al. (2010): Chr6:31475-33800 (orc1-bah-delta/wt peak ratio: 0.51)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:37304 (Trep: 42.4 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:35863 (Trep: 32.1 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:34000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:32666-33247

Crabbé et al. (2010): Chr6:32472-32995 (Activity detected in: mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-33 has unique ID: ARS602

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         ATTTCCATTTTT                     
  Shirahige et al. (1993):         TTTATACGTTTA                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      CTAATTTCCATTTTTGAGTTTAGGCGGTGCTTTC  
  Xu et al. (2006):      AATTTATACGTTTAGTTTTAACATCATCACAATG  
  Eaton et al. (2010):      AATTTATACGTTTAGTTTTAACATCATCACAAT   
ACS LOGO:   ACS_logo  

ARS at VI-33 has unique ID: ARS602

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-33 has unique ID: ARS602

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-33 has unique ID: ARS602

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-33 has unique ID: ARS602