Confirmed ARS at III-295

ARS318

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 7 genome-wide studies.

Genomic Location: Chr3:294396-295027
Within tandem intergenic space between YCR097W and TT(AGU)C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -151.2 ΔG° (kcal/mol) at location 294406.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 31.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-295 has unique ID: ARS318

Loading - Please wait...

ARS at III-295 has unique ID: ARS318

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:294396-295027


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): Chr3:293331-296698

Chang et al. (2008): Chr3:293331-296698


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:292895-295885

Shor et al. (2009): Chr3:291000-293900 (orc2-1/wt peak ratio: 1.01)

Szilard et al. (2010): Chr3:294825-294835

Müller et al. (2010): Chr3:293450-295925 (orc1-bah-delta/wt peak ratio: 0.72)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr3:294863 (Trep: 31.1 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:294500 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:294396-295027 (Activity detected in: ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-295 has unique ID: ARS318

Studies that confirmed an essential ACS element

  Chang et al. (2008):         TATCATGTTTTG                     

Studies that predicted an essential ACS element

  Eaton et al. (2010):      ATTTATCATGTTTTGGTATGATAATTTAATTTT   
ACS LOGO:   ACS_logo  

ARS at III-295 has unique ID: ARS318

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-295 has unique ID: ARS318

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-295 has unique ID: ARS318

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): PubMed | PubMed Central

Chang et al. (2008): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Chang et al. (2008): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-295 has unique ID: ARS318