Confirmed ARS at III-30

ARS304

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 2 genome-wide studies.

Genomic Location: Chr3:30199-30657
Within tandem intergenic space between YCL055W and YCL054W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -149.2 ΔG° (kcal/mol) at location 30579.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-30 has unique ID: ARS304

Loading - Please wait...

ARS at III-30 has unique ID: ARS304

Studies that cloned this origin

Study details not curated: Chr3:30199-30657


Studies that analyzed this origin by 2D gel

Szyjka et al. (2005): Chr3:27128-33342


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:29371-30601


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr3:30199-30657 (Activity detected in: rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-30 has unique ID: ARS304

Studies that confirmed an essential ACS element

  Theis et al. (1999):         ATTATAAATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTATTATAAATTTTCTGTCATCTCGACTTAGTAC  
ACS LOGO:   ACS_logo  

ARS at III-30 has unique ID: ARS304

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-30 has unique ID: ARS304

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-30 has unique ID: ARS304

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

Szyjka et al. (2005): PubMed | Mol. Cell


Studies that confirmed an essential ACS element

Theis et al. (1999): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-30 has unique ID: ARS304