Confirmed ARS at I-147

ARS108

Other names: proARS108

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr1:146703-147690
Within convergent intergenic space between YAL002W and YAL001C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -156.9 ΔG° (kcal/mol) at location 147283.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 18.2 min.
Yabuki et al. (2002) — Trep: 22.9 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at I-147 has unique ID: ARS108

Loading - Please wait...

ARS at I-147 has unique ID: ARS108

Studies that cloned this origin

Xu et al. (2006): Chr1:146703-147690

Müller & Nieduszynski (2012): Chr1:147404-147807


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr1:147533-147596

Xu et al. (2006): Chr1:147045-148360

Szilard et al. (2010): Chr1:147545-147555


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr1:151855 (Trep: 18.2 min.) (Confidence: 9)

Yabuki et al. (2002): Chr1:149269 (Trep: 22.9 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr1:147666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr1:147152-147652 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at I-147 has unique ID: ARS108

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TGTATTAAATATTTAGAAATGTTATACTATTTTT  
ACS LOGO:   ACS_logo  

ARS at I-147 has unique ID: ARS108

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at I-147 has unique ID: ARS108

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at I-147 has unique ID: ARS108

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at I-147 has unique ID: ARS108