Confirmed ARS at I-1

ARS102

Other names: proARS102

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr1:650-1791
Within intergenic space between chromosome start and YAL068C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -161.9 ΔG° (kcal/mol) at location 1391.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at I-1 has unique ID: ARS102

Loading - Please wait...

ARS at I-1 has unique ID: ARS102

Studies that cloned this origin

Xu et al. (2006): Chr1:650-1791


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr1:335-649

Xu et al. (2006): Chr1:25-2838

Shor et al. (2009): Chr1:200-2800 (orc2-1/wt peak ratio: 0.83)

Müller et al. (2010): Chr1:200-2375 (orc1-bah-delta/wt peak ratio: 0.72)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr1:950-1450 (Activity detected in: elg1, ctf8, ctf18, mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at I-1 has unique ID: ARS102

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TATTTTTATGTTTAGGTGATTTTTGTGGGGATTT  
  Eaton et al. (2010):      TATTTTTATGTTTAGGTGATTTTTGTGGGGATT   
ACS LOGO:   ACS_logo  

ARS at I-1 has unique ID: ARS102

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at I-1 has unique ID: ARS102

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at I-1 has unique ID: ARS102

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at I-1 has unique ID: ARS102