Confirmed ARS at X-442

ARS1015

Other names: proARS1015

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr10:442248-442658
Within tandem intergenic space between YJR003C and YJR004C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -148.4 ΔG° (kcal/mol) at location 442568.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 21.4 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-442 has unique ID: ARS1015

Loading - Please wait...

ARS at X-442 has unique ID: ARS1015

Studies that cloned this origin

Wyrick et al. (2001): Chr10:442248-442658


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:442300-442596

Xu et al. (2006): Chr10:441035-444475

Shor et al. (2009): Chr10:442100-443900 (orc2-1/wt peak ratio: 0.81)

Szilard et al. (2010): Chr10:442305-442315

Müller et al. (2010): Chr10:441950-444125 (orc1-bah-delta/wt peak ratio: 0.75)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr10:440433 (Trep: 21.4 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:441500 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr10:442248-442658 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-442 has unique ID: ARS1015

Studies that confirmed an essential ACS element

  Xu et al. (2006):         ATTTATATTTT                      

Studies that predicted an essential ACS element

  Xu et al. (2006):      TCGGTTCGATCATTTTTCTGCTTTTGTCGTACCT  
  Eaton et al. (2010):      TAAATTTATATTTTGTTCGTAAAAAGAAAAATT   
ACS LOGO:   ACS_logo  

ARS at X-442 has unique ID: ARS1015

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-442 has unique ID: ARS1015

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-442 has unique ID: ARS1015

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-442 has unique ID: ARS1015