Confirmed ARS at X-442

ARS1015

Other names: proARS1015

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr10:442248-442658
Within tandem intergenic space between YJR003C and YJR004C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -148.4 ΔG° (kcal/mol) at location 442568.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 21.4 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-442 has unique ID: ARS1015

Loading - Please wait...

ARS at X-442 has unique ID: ARS1015

Studies that cloned this origin

Wyrick et al. (2001): Chr10:442248-442658


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:442300-442596

Xu et al. (2006): Chr10:441035-444475

Shor et al. (2009): Chr10:442100-443900 (orc2-1/wt peak ratio: 0.81)

Szilard et al. (2010): Chr10:442305-442315

Müller et al. (2010): Chr10:441950-444125 (orc1-bah-delta/wt peak ratio: 0.75)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr10:440433 (Trep: 21.4 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:441500 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr10:442248-442658 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-442 has unique ID: ARS1015

Studies that confirmed an essential ACS element

  Xu et al. (2006):         ATTTATATTTT                      

Studies that predicted an essential ACS element

  Xu et al. (2006):      TCGGTTCGATCATTTTTCTGCTTTTGTCGTACCT  
  Eaton et al. (2010):      TAAATTTATATTTTGTTCGTAAAAAGAAAAATT   
ACS LOGO:   ACS_logo  

ARS at X-442 has unique ID: ARS1015

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-442 has unique ID: ARS1015

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-442 has unique ID: ARS1015

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-442 has unique ID: ARS1015