Likely ARS at IV-9

No systematic name assigned

Other names: proARS401, proARS402

Status: Likely ARS: Identified by 5 genome-wide studies.

Genomic Location: Chr4:7596-11052
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -168.3 ΔG° (kcal/mol) at location 9156.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-9 has unique ID: 91

Loading - Please wait...

ARS at IV-9 has unique ID: 91

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:7814-8683

Wyrick et al. (2001): Chr4:10706-11657

Xu et al. (2006): Chr4:7598-11050

Szilard et al. (2010): Chr4:8605-8615


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:7000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-9 has unique ID: 91

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ACTATTTAAATTTTTATTTTTCGGTGTTATTTTC  
ACS LOGO:   ACS_logo  

ARS at IV-9 has unique ID: 91

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-9 has unique ID: 91

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-9 has unique ID: 91

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IV-9 has unique ID: 91