Likely ARS at XI-236

No systematic name assigned

Status: Likely ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr11:235293-236577
Probably within tandem intergenic space between YKL108W and YKL107W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -162.3 ΔG° (kcal/mol) at location 236493.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XI-236 has unique ID: 717

Loading - Please wait...

ARS at XI-236 has unique ID: 717

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr11:235295-236575

Szilard et al. (2010): Chr11:236045-236055


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr11:235865-236365 (Activity detected in: pol2-12, tof1, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XI-236 has unique ID: 717

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTAAGTTTAGTGTCAGAATGCAAGCGTATATCT  
ACS LOGO:   ACS_logo  

ARS at XI-236 has unique ID: 717

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XI-236 has unique ID: 717

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XI-236 has unique ID: 717

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XI-236 has unique ID: 717