Confirmed ARS at IV-408

ARS414

Other names: proARS414

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr4:408070-408312
Within tandem intergenic space between YDL025C and YDL024C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -151.3 ΔG° (kcal/mol) at location 408280.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 26.3 min.
Yabuki et al. (2002) — Trep: 21.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-408 has unique ID: 108

Loading - Please wait...

ARS at IV-408 has unique ID: 108

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:408070-408312


Studies that analyzed this origin by 2D gel

Crabbé et al. (2010): Chr4:404295-409192


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:407247-408492

Xu et al. (2006): Chr4:407505-409225

Szilard et al. (2010): Chr4:408275-408285

Müller et al. (2010): Chr4:407825-408350 (orc1-bah-delta/wt peak ratio: 0.40)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:409855 (Trep: 26.3 min.) (Confidence: 5)

Yabuki et al. (2002): Chr4:406291 (Trep: 21.8 min.)

Alvino et al. (2007): Chr4:407250 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:407750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr4:408070-408312 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-408 has unique ID: 108

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TATATTATATTTAGCG                   
ACS LOGO:   ACS_logo  

ARS at IV-408 has unique ID: 108

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGAATAGCCGTTCATCTCTTTTATATTATATTTAGCGATGTAATGAAAGTAAAAAAA
S. kudriavzeviiAAAATGCCTATTATGTTCGGAATATTATGTTTAGTAATATAACGTGTGCAAAAGGA
S. mikataeGAAAAATATTTCACCTTCGCAATATTATATTTAGTTACTTAATTTAGGTAAAAAAA
S. paradoxusGAAAAGCGTTTCATTTCGGC-ATATTATATTTAGTTATGTAATATAAGTAAATAAA
:**::::*:*:********:******:***::*:***:::*

ARS at IV-408 has unique ID: 108

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-408 has unique ID: 108

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at IV-408 has unique ID: 108